December 5, 2011 CrEvo News with Ian Juby and CORE Ottawa

1) Portable Creation Museum Project: An update
2) Youtube producers and wanna bees: Epic Evolution Pwnage Contest!
3) Would you believe, new CrEvo rants?
4) Persuaded by the evidence – part 2
5) More Chimp and Human DNA stuff
6) Donating to CORE Ottawa
***************************************************************************
1) Portable Creation Museum Project: An update
It’s been too long since I sent out an update, or managed to get any real work done on the portable creation museum project. I’m excited to give this update, and I’ll be sending out some updates over the next several months as I work on exhibits.
Here is an update video showing the containers and the prototype leg for the lift system, and I talk on where we’re at, some of the challenges, and the steps I’ll be taking the next little while.
http://www.youtube.com/watch?v=Fu1sPZomJX0
I’m especially excited over the next several months as I start working on building some new exhibits (animatronic dinosaurs, and Grand Canyon model in particular), as well as upgrading all of my present exhibits to be a stand-alone exhibition. Why? Well I’m so glad you asked! :)
In the new year, I am already booked into two venues with my museum as a special exhibition. As many of you who have seen my exhibits know, they are not “stand alone.” In other words, I need to be there to explain what each artifact is and why it’s significant. A stand-alone exhibit has plaques and a method of display for each artifact, which is what I’ll be working on over the next several months. I held a vote on facebook, and facebook friends voted to start on Dracorex for the first animatronic dinosaur, so I’ll be starting on that and the Grand Canyon model.
Remember you can follow along with the project here:
http://ianjuby.org/creationmuseum.html
Wanted: Secular Exhibition Venues!
If anyone out there in cyberspace has a secular venue and would like to have a creation museum come be a special exhibition for you, please contact me. I am confident it will draw crowds to your business! We can work out a deal as my hope is that the museum will not cost you anything except space. My hope is that the bookstore and admission fees will cover the costs of the exhibition. Or if you have a rental hall you think may be suitable, we can talk. Or perhaps you would like to sponsor space in a rental hall for the exhibition in your home town?
The set up will be extremely flexible – I should be able to fit it in as small a space as say, 400 square feet, but 1,000 to 1,200 square feet would be ideal. The exhibition will have displays from biology, geology, a large Grand Canyon model, a Noah’s ark model, dinosaurs (hopefully at least one animatronic dinosaur), fossils, and one of the largest displays of fossil human footprints in the world – almost all of those footprints are among dinosaurs. The exhibition will also include a mini theatre (depending on floorspace availability), with custom movies which are short and expouding upon various scientific evidence pertaining to Biblical Creation.
***************************************************************************
2) Youtube producers and wanna bees: Epic Evolution Pwnage Contest!
Here’s your chance to get a whole pile of views and publicity for your youtube channel, win a classy Captain Antagonator costume, all three volumes of my CrEvo Rants on DVD and even $50!
All you have to do is impress our four youtube celebrity judges enough that they deem your video the winning entry. Make a video less than two minutes in length explaining your favourite scientific evidence against evolution or for creation (even though usually the two are one and the same), and post it as a video response to the contest announcement video.
Be creative! It’s youtube – you don’t have to be fancy, it’s an issue of using what you already have to its maximum potential.
Spread the word around – contest closes January 7, 2012 at midnight, eastern standard time. See the announcement video for contest details:
http://www.youtube.com/watch?v=5ALzj-ysB8g
Get writing, scripting, shooting and producing!
***************************************************************************
3) Would you believe, new CrEvo Rants?
Bwaaahahahahaa! I admit it, I have fun producing rants. I wish I had more time to produce more. Many more are “in production” and I release them as I can. Here’s the two latest.
Remember to rate and rant, as the anti-creationists loooove to pick on my videos, voting them down and adding nasty comments on youtube. So please do share the videos with everyone you know – I would be grateful.
The Population Problem, CrEvo Rant #71
Define “evolution”, CrEvo Rant #41
***************************************************************************
4) Persuaded by the evidence: Part 2
Still chugging away to get this long-overdue video released, part 2 is now online with Dr. Jerry Bergman and Alan Montgomery:
http://www.youtube.com/watch?v=SKPKuk6gF-4
Dr. Bergman was interesting to interview in that he actually sought out and investigated multiple religions before concluding that Jesus Christ was the Creator. Alan Montgomery had never really thought about it, until he had a personal encounter with His Creator.
Hear their stories for yourself, and share the link.
http://persuadedthemovie.com
***************************************************************************
5) More Chimp and Human DNA stuff
Now that the chimpanzee genome has been unravelled…..wait – you didn’t know that it had not been unravelled? Oh – you’ve probably heard the claims made for over a decade now about how humans and chimps share 98.4% of their DNA huh? Yup, such claims were made with very little of the chimpanzee genome actually decoded! It’s like reading one book, then reading the first page of a completely different book and saying the two books were almost identical.
Unfortunately, that analogy holds true in far more ways than one realizes. Not only did the evolutionists who made this claim have very little of the chimp’s “book,” to compare to the human “book,” they ignored huge portions of the parts of the book that they did have!
So last year the chimpanzee genome was finally decoded and made public – yet strangely the evolutionary community was quiet on many aspects of the genome. Presumably because of all the unexpected contradictions to the evolutionary theory that were being discovered.
First of all, coming back to the “Human and Chimpanzee DNA is 98.4% identical” claim, as I mentioned in a previous newsletter (“Meet your relative, the sponge”), we only had an estimate
![]() Can you imagine buying products that use the rules of evolution? |
of the length of the chimp DNA – which was around 10-15% longer than the human DNA. We now know it’s about 12% (you can download, view and compare the DNA sequences of multiple critters here: http://hgdownload.cse.ucsc.edu/downloads.html). So how then can the chimpanzee and human DNA be 98.4% identical when one is 12% longer than the other?
The 98.4% figure (or 99%, depending on who you ask, obviously the number doesn’t matter because it’s ludicrous) was arrived at by ignoring huge portions of each DNA. You have to dig to find this out and get the evolutionary “researchers” to admit this. But it gets worse. To understand this, let’s do a little crash course on DNA and chromosomes.
Crash course in chromosomes:
Chromosomes are bundles of DNA. Humans have 23 pairs of chromosomes, and each chromosome contains unique DNA. Two of the chromosomes are linked to gender, known as the X and Y chromosomes. Women have two X chromosomes while men have one X and one Y chromosome. If you were to unwind the DNA in each chromosome, all of it put end to end makes up your genome, or your entire genetic code (DNA).

Male human chromosomes
The DNA is made up of four chemicals which are represented by letters A, G, C, and T. These four letters in sequence make up the instructions on how to build you. Sequences of these letters contain specific instructions to do specific things (like making an arm for example), and these sequences are called genes.
So now to compare chimp DNA and human DNA, the evolutionary researchers lay the chromosomes of the two critters side by each to see how the letter sequences and genes line up.
In short, they don’t line up.So this is where some rather… *ahem* creative liberties are taken to make the comparisons. The evolutionary researcher will find the gene that codes for say, the appendix in the human DNA, and they will find the gene that codes for the appendix in the chimp DNA and compare them. While it should come as no surprise that they’re similar, you’ll please notice they have just ignored some 99% of the entire DNA to make one comparison. And all too often that comparison arrives at figures of 98.4% identical – which should come as no surprise to an engineer.
You see, as a robotics engineer, I’ve had people spontaneously say that they can recognize a robot I built by its design. This is because what works on one robot, works on another completely different robot. So I use the same design and parts on different robots. This is efficient design and has nothing to do with one robot evolving into another! This is evidence of a common designer.
The fact that two completely different robots have the exact same gripper would be called a homology, or a homologue.
So yes, you will see homologues in life – we creationary thinkers would say it’s evidence of a common designer, not a common ancestor. In fact, to use the robot analogy some more before we actually compare the chimp and human DNA, let’s say I use the exact same robotic gripper on two robots: One is a land roving robot, the other is a submarine robot. The land rover has the gripper attached to the end of a robotic arm, but the submarine has it attached to the frame, to grab things to hold the robot in place.
So while both robots have the exact same gripper (evidence of a common designer), the location of the gripper is completely different (which is good evidence that one robot didn’t evolve into the other <grin>).
This is, in effect, what we see when we compare the chimp and human genes, and you can look at the comparisons yourself on the ensembl website.

You can get a wonderful tour of what I’m going to talk about here by youtuber Hugenex2000:
http://www.youtube.com/watch?v=Ey5MuAgLWd8&feature=player_embedded
The big chromosome up the middle of the image above is a human Y chromosome. The chimpanzee Y chromosome, for comparison, is in the upper left. The first problem you’ll notice is that the graph actually shows two other chimpanzee chromosomes. Why? Because the gene in the human corresponds to the gene in a chimp on a completely different chromosome!
So not only are the genes different from each other, they are in radically different places – like the robots having a similar gripper in completely different locations. In fact, take a look at the lines connecting the genes from the chimpanzee Y chromosome (upper left) with the human Y chromosome, and you’ll notice that the genes are in completely different locations.
Chimpanzees and humans were supposed to have evolved from a common ancestor, and therefore the genes should be in relatively the same places between the organisms. But they are not even close! The order is completely switched around. This is supposed to be “98.4% similiarity.”
ORFan genes:
Scouting around in ensembl, in the bottom right hand corner, click on “15 downstream genes.” This will list the first 15 genes in the human and chimpanzees.
You’ll notice right off the bat that the first four genes in the human have “no homologues” in the chimpanzee. In other words, these genes are unique to the human. These are called Orphan genes, or ORFan (for Open Reading Frame). Chimps and humans both have hundreds of orphan genes. The orphan genes have a 0% DNA match between humans and chimpanzees – but you never hear about that when the anticreationists cite the similarities between human and chimp DNA as evidence for evolution, do you? That’s because it doesn’t help evolution – in fact, it poses another challenge for evolutionary theory: If evolution works by “descent with modification,” HOW did so many unique genes arise in each species?
This is an especially important question when you realize that a lot of these orfan genes are crucial to the organism’s survival!
Forget cold fusion – we got chromosome fusion!
Just as bogus as the 98.4% similarity claim, some evolutionists have also claimed that the common ancestor of the chimp and human had 24 chromosomes, and two of the ancestor’s chromosomes “fused” together into one chromosome somewhere along our ancestry, which is why humans only have 23 chromosomes.

At the alleged fusion location, it was claimed there were found telomere sequences. Telomeres are at the very end of the DNA chain in a chromosome, and it’s like a marker to show the DNA-reading equipment where the end is, and to protect the DNA from fragmentation at the more vulnerable ends of the DNA. Telomeres are simply thousands upond thousands of repeats of six of those letters that make up the DNA, like this:
CTGAGATCCCGCGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG…
The first telomere sequenece (TTAGGG) is marked in purple, and you can see it repeating in red. This continues on for usually many thousands of repeats at the end of the DNA.
So, the evolutionary community claimed there was a telomere sequence right smack dab in the middle of the human chromosome 2, right exactly where evolution predicted if the two ape chromosomes (named 2A and 2B) had fused.
This claim was promoted quite a bit by theistic evolutionist Dr. Ken Miller, who brazenly promulgated the claim in spite of the evidence against it.
For example: when did this fusion occur? How did the 24 chromosome sperm fertilize a 23 chromosome egg, or vice versa? We’re talking extinction of the species here, so this is obviously an important question that Miller and the fused chromosome supporters have swept under the rug!
Anticreationists are frankly quite cocky with this claim, as can be seen by a video posted as a response to a video I have on my channel, a debate between Laurence Tisdall and Jason Wiles, on the Michael Coren show.
The skeptic’s video is entitled “How to shut up pesky creationists.”
http://www.youtube.com/watch?v=dK3O6KYPmEw&feature=related&fb_source=message
Unfortunately for the skeptic, it doesn’t shut me up, in fact, I’ll be posting my own video response to his video shortly. <big ‘ol grin>
Chromosomal fusion zombie – dead long ago, but still wanting to eat yer brains…
Evolution and the chromosomal fusion claim are very much like a zombie: Already dead, walking, and wanting to eat your brains.
Enter Dr. Bergman and Dr. Tomkins, zombie slayers extrodinaire. :)
Their article which came out this fall utterly destroyed the chromosomal fusion claim once and for all. (Journal of Creation, Volume 25, issue 2, fall 2011, “The chromosome 2 fusion model of evolution: re-evaluating the evidence.”)
In that article (and a layman’s article synopsis by Dr. Tomkins), they lay out all the nails with which they seal the coffin of the chromosomal fusion zombie:
There is no telomere at the alleged fusion site:
-at the alleged fusion site there was only found a sequence which was vaguely akin to a telomere sequence, with lots of differences to regular telomere sequences, and it was too short!
The telomere sequence was in the wrong spot:
-there was, however, a very nice “telomere sequence” found waaaay down the DNA chain – far away from the alleged “fusion site”

Nearly every chromosome had a “fusion site”:
-obviously telomere sequences in the middle of a chromosome does not indicate a fusion, because nearly every human chromosome had alleged telomere sequences in the middle of it! Obviously, there’s more going on here than meets the eye.
No corresponding DNA sequences:
-if the human chromosome 2 was the result of 2 ape chromosomes fusing, then there should be sequences on either side of the “fusion site” that match the chimp DNA, right? This was not the case – the DNA sequences on either side were quite different than the chimp sequence.
There’s much more to this subject, but I’m trying to keep this article short and relatively simple. If you want to wade into the technicalities of this fascinating subject, you can look up the references and read until your brain explodes….and the zombie eats your brains….
Some more reading:
http://www.uncommondescent.com/intelligent-design/why-the-chromosomal-fusion-argument-doesnt-wash/
***************************************************************************
It’s the end of 2011, and for those who are making end-of-year donations, please consider making a donation to CORE Ottawa. CORE funds go towards sending myself out to minister in various places around the country, and donations to CORE are tax-deductable.
Donations to CORE can be made at the one-stop donation location, Canadahelps.org
By donating through Canadahelps, you can donate to multiple charities all across Canada, and get one tax receipt.
Or you can make a donation by cheque payable to CORE Ottawa, and mailed to:
CORE Ottawa
Kanata North Post Office Box 72075
Ottawa, ON.
Canada
K2K 2P4
And thank you for your kind and generous donations, they help keep this ministry on the road.
***************************************************************************
These newsletters typically take about 20 to 40 hours worth of work, and I insist on keeping it free. I have had many people ask me to include info on how to donate towards this ministry. If you don’t need/want a tax receipt,you can donate online here,or you can support this ministry and get a tax-deductable receipt by mailing a donation (checks made out to CORE Ottawa) to CORE Ottawa, Kanata North Post Office Box 72075, Ottawa, ON. Canada, K2K 2P4 And thank you to those who support both prayerfully and financially.
Subscribing and Unsubscribing:
If you received this email from a friend,and would like to subscribe yourself,click hereand enter your email address into the “CSMC” subscribe box. May I also suggest you sign up for the free “In 7 Days” crash course in creation.

January 15th, 2012 at 8:01 am
Well, I finally found the article in which you mentioned my video and it would seem that you have also been reading my blog articles on genetics and genomics. Thanks for the mention here in your newsletter/blog. It is encouraging to know that somebody is paying attention, even if you are from Canada[A].
Grace and Peace to you,
Eugene